Home page

Nodata How www.mommanextdoor.com




Video quality The size Download

Information Nodata


Title :  Nodata
Lasting :   12,45
User :  
Date of publication :  
Views :   405
Liked :   979
Downloaded once :   212


Frames Nodata





Description Nodata



Comments Nodata



Askar Razik
i ate dinosirus at kfc
Comment from : Askar Razik


Legal Vampire
'It's not always survival of the fittest. Sometimes it's survival of the luckiest'
Comment from : Legal Vampire


Jeffrey Lucia
Existence of God depends on what you accept as evidence. Since you are a figment of your own mind, we'll just ignore it or me or the argument or...?
Comment from : Jeffrey Lucia


Jeffrey Lucia
No. His typical presuppositions have been repeated for years. Also, it is rare to find ANY fossils that are all put together under piles of dirt. Most bones are scattered and many missing or just gone. For the most part, fossils do not remain but decay into nothing or varying degrees of soil, dirt or just some form of carbon. Also, why not include some or all of situations when evolutionary scientists were wrong. The carbon dating method is also flawed especially after 10,000 years. Must I go on? By the way, the sun is not eternal.
Comment from : Jeffrey Lucia


black channal
Why evolution is not happening now where are the bones of individuals between apes and humans
Comment from : black channal


unusual score
I think it is a straw man to say that religions don't teach evolution. perhaps Christianity doesn't and that's what he is referring too since Darwin was in Christian lands. I know in Islam there are many Teachings that seem to be in line with evolution. For one , one of Allah's names/attributes is
Al Bari - The Evolver. Allah also states in the Quran Surah 6:133 And your Lord is the Free of need, the possessor of mercy. If He wills, he can do away with you and give succession after you to whomever He wills, just as He produced you from the descendants of another people.
also Quran 21:30 says
Have not those who disbelieve known that the heavens and the earth were joined together as one united piece, then We parted them? And We have made from water every living thing. Will they not then believe?


there's more, about, being created in stages, and much much more, if anyone is interested I can give more references.

Comment from : unusual score


Man WOn In Christ
HOLD ON πŸ–πŸ½1 SECOND. TALKING ABOUT FOSSIL .
Of course they going to be Older than mankind
. Because before I can put mankind on earth I have to Creat the environment for him to inhabits it. So obviously before I started having children with my wife we made a house and put furniture in and prepared cribs etc. According to our planning. 😳😳😭
Where is yall BRAIN mr. Scientist?
O Father God I pray you Give these brains instead of water in their heads. 🀣🀣
. The got caught up in the details of creation and lost sight of the creator.

Comment from : Man WOn In Christ


Man WOn In Christ
HOLD ON πŸ–πŸ½ Whom I going to believe The 6000 to 2000 Scriptures OR just few years ago Flyby night SCIENTISTS with experiment, he not sure so his BOOKS is EDITIONS EDITIONS EDITIONS 🀣??
. LπŸ‘€KπŸ‘‰πŸΎ Hebrews 11v3 KJV Through faith we understand that the worlds were framed by the word of God, so that things which are seen were not made of things which do appear.
Hebrews 11:3 KJV
πŸ‘‰πŸΎQuestions. Have you ever seen man thoughts???
● Colossians 1: 16. Whom Should I BELIEVE πŸ‘‡πŸΎ
For by him were all things created, that are in heaven, and that are in earth, visible and invisible, whether they be thrones, or dominions, or principalities, or powers: all things were created by him, and for him:
🀣🀣🀣🀣🀣🀣🀣
πŸ‘‰πŸΎCaboom 2 STARS Collided and out come earth and then humans built cities and civilizations 🀣🀣🀣🀣BUNCH JUNK 🀣🀣🀣🀣🀣🀣

Comment from : Man WOn In Christ


Joel Mamachan
I understood everything up until the point he said: why?

Answer: Because they have a common ancestor.

Well, we dare ask "why" again because... its science! It doesn't need any explanation!


My conclusion is I think we know the common ancestor: God πŸ˜‚

Comment from : Joel Mamachan


Oisin Lally
Wouldn't say this guy has spent much time in the dirt!
Talks a good game though!
James Ussher was a formidable scholar for his time and dated the passing of Alexander and Caesar. Tad more respect should have been offered.

Comment from : Oisin Lally


Tim Account
This video needs a new title. Pointing to a bunch of fossils and seeing that they have similarities does NOT prove evolution is true.
Comment from : Tim Account


Jefferson Barnes
In the beginning God created the heaven and the earth.Β  -Genesis 1:1
Comment from : Jefferson Barnes


RADIOACTIVE
Obviously, there are lots of assumptions based on theories calling it true....
Comment from : RADIOACTIVE


The Hood Pastor
And where is the missing link there should be millions of fossils of the missing link not just 13 throughout the entire world. And every dinosaur died except birds so birds were able to flyweight from the snow that packed the land the flooded streams that turned into rivers and rivers that turn into oceans yeah this makes no sense cuz he eventually even Noah's dove had to find somewhere to land
Comment from : The Hood Pastor


Jacques Gauthier
A shame he stopped in the late 1800's and made no mention of DNA and how bacteria acquire gene sequences from other bacteria.
Comment from : Jacques Gauthier


Sigga317 swillie
Nice story. I was waiting to hear the science of evolution . All I got was a theory and fossils . Wtf ..? No mitosis ... no fussion .. no editing of the genetics by mother nature .. no missing link .. An older man once said to me there is nothing new under the sun. So if there was an armadillo like creature millions of years ago there would be something similar now. Hmm.. ???
Comment from : Sigga317 swillie


Thomas Jefferson
There was a point in time where "man' became something very different than what we were just previous. For some strange reason we got incredibly smarter about 13,000 years ago. I believe that over time things we don't understand changed us dramatically in a very short amount of evolutionary time. This is where the religious theories come from. I believe both the theories are true in a way. Something intervened in our DNA sequence and made us what we are today. Call it God or nature or whatever you want but it made us the people we are today.
Comment from : Thomas Jefferson


Don Ryder
How could the artist have come up with that depiction of the ancient earth? Did the artist get to live a billion years?
Comment from : Don Ryder


Mehbub Javin
Well, still it has no clear evidence. I mean, come on! If all the creatures are living in same kind of atmosphere, they will definitely have similar structure, don't you think?
Comment from : Mehbub Javin


elmo omle
The 'THEORY" of Evolution is found to be true?? So, it's now the LAW of Evolution??
Nah...it's still the Theory, of evolution. (only because 'academics' , must, collectively, dismiss any potential of a 'creator' ).
Hilarious propagation of a second rate theory eschewed in an academic echo chamber. Sad.

Comment from : elmo omle


rose orphee
The missing link is a spirit from another dimensiΓ³n. He's hiding in plain sight; it call possession. Most human history talk about dealing with, higher being who take human form. That called a consensus
Comment from : rose orphee


Ad Roest
Geologists, evolutionists and creationists are walking in the dark as long as they deny ancient books like the Mahabharata and the Popol Vuh, that tell us that Earth is suffering from a cycle of natural disasters. Such a cycle can only be caused by a heavenly body that approaches the Earth with long intervals. That must be Planet 9. These disasters create a cycle of civilizations. If you don't know this cycle, history is incomprehensible. To learn much more about the cycle of civilizations, recurring floods, and ancient high tech, read the eBook: "Planet 9 = Nibiru". Search for: invisible nibiru 9
Comment from : Ad Roest


Timothy Keith
The problem with Darwinism is it can't explain the origin of life, doesn't even attempt to do that. Darwin's theory isn't all the innovative. The idea that the weaker individuals are more likely to perish in any given population isn't particularly insightful. The Miller–Urey experiment of 1952 is still given as evidence for abiotic materialization of amino acids, when its known that the conditions of that environment would be destructive to the very thing it proposes to create. There isn't any testable theory on the original of life. There isn't any explanation of a proto organism that lacked DNA, yet alone the other cellular structures that make sense of DNA. How could that first semi living thing appear to live, and why can't it be created in a laboratory today?
Comment from : Timothy Keith


claudio zanella
Evolution is not true: it's the shame of science. That theory exists only for monetary purposes. All you need is to go to a public library and look for fossils pics. You will see that all the intermediary species claimed by the evolution theory is just fantasy.
Comment from : claudio zanella


King Kush
You guys actually think we share a common ancestor with bananas?? Can any of you explain where consciousness come from. Matter is not conscious. The brain is made of matter like your banana. Why are you conscious?
Comment from : King Kush


dodoki36
So many mistakes in this video. I almost lost it when he talked about embryos. This argument is flawed and has been dismissed a long time ago ! Shame.
And no, the synthetic theory of evolution is not proven to be true.

Comment from : dodoki36


James Benton Ticer
STOP SMACKING YOUR LIPS!
Comment from : James Benton Ticer


Jedrek Sirca
DNA is information and it is a natural law that all information comes from a mind. Someone explain that along with the fact that mutation has literally never added DNA or information. Evolution has not been observed and information has never come from just matter without an intelligent source. Evolution isn’t exactly scientific.
Comment from : Jedrek Sirca


Onome Monioro
Hated that he had to rush to round up at the end. Enjoyed the presentation
Comment from : Onome Monioro


Beverley Donaldson
IIMPORTANT! to note...evolution is true for the animal kingdom as there is evidence everywhere to support that...but nothing to explain the sudden appearance of man as well as no evolutionary evidence...why? Simple...we were created by GOD!!! If you want proof...go to NDE's..not all those thousands of people who had experiences can possibly be talking nonsense! Dont be fooled...
Comment from : Beverley Donaldson


WowPowGamer
Very good informations.
Comment from : WowPowGamer


Ron Tarrant
He stopped before presenting the evidence of his title thesis. Not exactly scientific.
Comment from : Ron Tarrant


Wise Bluehillwarrior
Less than a minute in, already cringing. False assumption = People were desperate to believe in God.
In reality they were desperate to believe he wasn't real so they were ready to accept anything else, if it seemed just somewhat plausible. Being morally subject to an all powerful being was not a very well liked state for many. Sure the culture was religious, the people however were absolutely not.

Comment from : Wise Bluehillwarrior


nat Sch ism
The people that don't understand evolution are the living evidence of the evolution in human history.
Comment from : nat Sch ism


alnot01
The message of the creation story set out in the first few chapters of Genesis is as follows:
* the universe and the solar system began a finite time ago;
* the universe started out in a very simple and highly energetic state;
* the solar system started out devoid of life, but life of increasing complexity gradually emerged.
These points of Judaeo-Christian mythology are not contradicted by contemporary science.

Comment from : alnot01


Wise Bluehillwarrior
Classical fallacious equivocation. "Microevolution is proven and here is the evidence, therefore Macroevolution is true".
Comment from : Wise Bluehillwarrior


TheHairy Heathen
Creationists remind me of Corporal Walter Eugene "Radar" O'Reilly reaching out for his teddy bear to comfort him, while the 4077th M*A*S*H was being bombed and shelled by the North Koreans. Creationists just have an invisible, imaginary, make believe friend to comfort them instead of a teddy bear, but demonstrate the same level of emotional immaturity. They're kind of cute and lovable and you just want to smile and pat them on the head condescendingly and tell them what good children they are, while simultaneously holding back tears of laughter at the absurdly ridiculous, incredibly innocent naive things they claim.
Comment from : TheHairy Heathen


Ryan Taylor
Darwinism is a pre-k non-scientific observation (its not a theory) that can be summed up in three words:

What survives, survives.

Well, nO dUh. So deep.

Darwinism is rejected by real science today. The cambrian explosion itself completely obliterates Darwinism. Darwin mentions this himself in his own book.

A nice accent is just a mask for nonsencical BS.

Good Job, Tedtalk.

Perpetuating a falsehood

Comment from : Ryan Taylor


Thomas Borisov
still waiting for concrete evidence for evolution, maybe if i wait long enough ill evolve to fly and breathe underwater
Comment from : Thomas Borisov


Don Quixote
Stop trying to debate creationists, by their very nature they have "faith," that's not belief, there is a difference, basically they perpetrate ignorance as their shield and are quite happy to live by this belief in the face of all scientific evidence.
Comment from : Don Quixote


Saul Espino
wishful thinking
Comment from : Saul Espino


ish the fish
Lieessss
Comment from : ish the fish


Arthur Manning
too much handwaving and no explanation of proof. glossed over the proof of cladistcic trees. embryology has been debunked due to our dna knowledge. after this talk there is plenty more to doubt
Comment from : Arthur Manning


jock mactaggart
Preach
Comment from : jock mactaggart


L.Ron Dow
A copy of Don K's (account: UCIWF_SttFhFJ7JZuzxS8U0w) thread - he likes to delete replies that paint him in a bad light.

Don K
DIVINE PROPORTION
Contrarily the easily observed truth has always been known and scientific research via advanced technology only confirms Creationism


L.Ron Dow
Is it true Don Key that as soon as you get some critical comments, you delete the thread and start a new one? Truly a man of convictions, NOT.
While I'm here, can I ask you for an example of 'Scientific Research' that confirms creationism - and tell us what 'Advanced Technology' that would be using.


Don K
@L.Ron Dow
The comments are deleted because they are just superstitious antitheist, unscientific, incoherent babbling and irrelevant infantile personal attacks like yours


Don K
2 hours ago
@L.Ron Dow
You are making fun of my name associating it with a "Don Key" when that is not even the correct pronunciation showing off how daring or cool you are


L.Ron Dow
@Don K "The comments are deleted because they are just superstitious antitheist, unscientific, incoherent babbling and irrelevant" Then why not just call them out as such and leave them for the world to judge? What you did is completely lacking in respect - people spent time replying to you and you rendered that time wasted. A Donkey has more integrity than you.

If you consider yourself to be Christian then you should be cognizant of the spirit of 1 Peter 3.15 - and if not, you should check it out - it's some of the good human wisdom you will find in the scriptures.

Shame on you.

Just to make sure this thread has a little more permanence, I shall copy it to a new thread under my control.

Now, why don't you show some backbone and provide some evidence for you assertions - as I asked?

Comment from : L.Ron Dow


Don K
1 TIMOTHY 6 20
Materialism is a horrid morbid death, religion preaching that organisms
are not sacred and nothing more than a soulless mistake or literally like
"junk DNA" refuse in a universe devoid of purpose, consciousness or
intelligence headed only towards permanent extinction.

Comment from : Don K


MAD GRUMPYMAN
The problem is dishonest, simple, stunted, irrational gawwwd maggots who want to have an imaginary magic friend in the sky, more then TRUTH itself! These repugnant, delusional MAGGOTS must be mocked, ridiculed, shunned, challenged, exposed AT EVERY OPPORTUNITY! The politicians will forever support any form of LUNACY which is in their favor, and irrationality, ignorance, cowardice, DEFINITELY WORKS WELL FOR THEM AND THOSE THEY WISH TO MANIPULATE AND DECEIVE!
Comment from : MAD GRUMPYMAN


mito . . .
very good!
Comment from : mito . . .


Don K
DIVINE PROPORTION
Contrarily the easily observed truth has always been known and
scientific research via advanced technology only confirms
Creationism

Comment from : Don K


Shakdi Dagalimal
9:33 "This is the first one, the first image of the ancient earth."
There you have it, the arrogant and hubristic lies these idiots tell themselves.

Comment from : Shakdi Dagalimal


Stuart Foster
The devils toe nails , your Fear !
Comment from : Stuart Foster


Edruezzi
The scientifically illiterate Creationists will simply have to deal with the fact that biology makes NO sense without Darwinian evolution.
Comment from : Edruezzi


Val Sarff
Those two things don't make sense because you compared two different groups. The first in the 1870's was the scientific community. The second group was, "many people". We also know that radioactive decay and therefore dating is not consistent, varying according to cosmic particle forcing. I believe very much in evolution, but I've seen more convincing arguments than yours based almost solely on electromagnetic primary forces.
Comment from : Val Sarff


Ayotte Drums
Bacteria remain bacteria dogs remain dogs...There is a huge misconception of Macro Evolution (cows turning into a whale) vs Micro evolution changing beak size in birds etc.... Most biologist are slowly realizing that the theory of evolution is highly flawed and in 60 years there is a ton of less evidence supporting it and a ton of evidence disproving it.....James Tour a Chemist who is considered one of the top minds on the planet really puts up a good argument that NOTHING can exist without molecules. His basis for the argument is that molecules don't care about life there is no pre disposition that drives a molecule towards life....
Comment from : Ayotte Drums


Levi Walker
Opinion
Comment from : Levi Walker


george beotes
Watch the Video on YouTube: "David Berlinski's Disproves Evolution in Five Minutes" on YouTube
Comment from : george beotes


healthdios
Brings back memories of my elementary school days in the 80's and how I came up to understand how small our human lives are in reality. Even though I was raised a catholic, my cathechist instructor told me no to take my religious teachings literally and I think that helped me and so many other kids my age to cope with the contradictions of my public school education vs church. Now I am in my mid forties and personally, the best way to understand the whole context of his presentation is to accept the continuity of these succession of developments. Evolution doesn't stop, it keeps going.
However, the dislikes on this video are from folks who refuse to stick their neck outside the comfort of their religious group. They rather live their short existence in that cocooned state of mind.

Comment from : healthdios


Nickolas Ramos
fossils are and can be made in months rather than years. Look up fossil boot from miners thought to be from 10,000 years ago is only less than 100 yrs
Comment from : Nickolas Ramos


Daddy hermanson
Gives absolutely ZERO information or evidence for evolution? Discusses fossils and geology? Fossils and geology are not evidence of evolution not sure how is trying to connect the dots here ?
Comment from : Daddy hermanson


Narciso de Almeida
Many kinds of Man were created in Labs just like Dinosaurs in past civilizations.who ever does not grasp this then you just a clone,no soul to give you awareness.
Comment from : Narciso de Almeida


Narciso de Almeida
Mankind Exists on Infinite number of Universes,we mankind are co-creators of this infinity
Comment from : Narciso de Almeida


Paul Morphy
Here's the first 1000 nucleotide bases that creates a cat...

ATCAGGAGATCTAGATGCCTGGAGAGGAGTGGAGAAAACGGGAAACCCTC TTATGGGAAGAGGTAATATGTATTTCTCCTTCGAATATAAAAAAAGTAAA AAGAAGGAAAACTTACCAAATTCACTTATGAGCCATTCATTACCCTGATA CCAAAACCAGATAAAGCCCTCCACTAAAACCAAAACTGCAGCGGCGCCTT GTGGGCTCGGTCGGTTTTACTGTCCAACTCTTAATTTCAGATTAGGAAAT AATCTTGCGGTGCATGGGTTCAAGTCCCACGTTGGACCCTGCCATGACAG TGTGGGGAATGGCTAGGATTCTCTCTCTCCCTGTCTCTCTGCCCCTCCCT CACTTTTTTGTACTCTAAGGAAAGAAATAAACATTTAAAAAAATGTTGAA AATTTTTTAAATAAAACTGCATACCAATAGCCTTGATGAGTATGTATGCC GAATTCTTCATTAAAAATACCTCAAATTAAATTCAAACAATACATTACAT AGAATCATTTACCATAATCAAGTGGGATATATCCCTGGCTTCAAGGGTGG TACCACATTCACAGATCAATCAACATGATGCACCACAGTAATAGAAGAAA GGATAAGAACAATATGATGCTTTCAACAGATGCAGGAAAACCATTTGACA AAATGTCACATCCATTCATGATAAAAACGCTCAGCAAATACATTGAGACT CAACCTACCTGCACATAATAAAATCAATCTAGGAAAACCCACAGCTAATC TCATCCTCAATGGGGAAAATTGAAAGTTGTTCCTCCAAGGTCAGGGACAA GACAGGGATGACCCCTCTCACCGACTGTTATTCACATAGTACGGGAAATC CTAGCCACAGCAATCAGACAACAAAAAGAAATAAGAGGCATCCAAATCAG CAAGGAAGAAGTAGCACATTTTCTATTTGGAACTGACATGATGTGCTCTA TAAGAAACATGAAAGACTCCCTTAAAAATTGCTAGAATTGATATATGAAT

What is the function of these bases and how should this sequence be continued in order to create a cat? Once you are as intelligent as the creator/designer of animals then you will be able to complete this sequence of nucleotide bases that can create a cat. Obviously, this is from a genius with an extremely high IQ. Nobody on the planet is intelligent enough to complete this sequence.

Comment from : Paul Morphy


John Francis
The only problem is that not the millions of years viruses have existed and thousands of mutations every day still haven't figured out how to replicate their Genetic material by themselves......Proves that random mutations don't take you no where .... Only guided mutations will result in evolution
Comment from : John Francis


Jean Corriveau
Creationists believe that intelligence comes from God and that His intelligence designed life and its evolution. Suppose that intelligence and knowledge come from God. Intelligence by itself serves nothing. It requires information. If that information comes from God, then it had to find its way through evolution. But living cells have no such ability to store information. They have memory only through chemical reactions. So, God’s information/wisdom could not have passed into life and through evolution. Intelligence by itself does nothing. It only serves a purpose when fed with information. There is no information in living cells. Information is our brain’s interpretation of microbiology. Nature has no such ability. So, God’s intelligence is useless. There is no reason to believe that God is the source of intelligence! It cannot be.
Comment from : Jean Corriveau


setag54321
NOPE! ....We still don't know Evolution is True.... He NEVER mentioned the Missing Link...All he did was parrot/regurgitate what he was taught at the Memory Schools...nothing new here Folks. Let's also REMEMBER the Evolution Academics are not much different than the Religious Zealots....One states it was all started by a "Lightening Bolt through the Sky charging particles" and the other states, "Man was made from the Dirt of the ground and Eve from a Broken rib of Man" ....both are NONSENSE without Evidence & pure Assumptions. Period!
Comment from : setag54321


Mike65809
"So the next time you have chicken, remember, you are eating dinosaur." Really? Can he prove scientifically the Archaeopteryx is related to the chicken? What foolishness.
Comment from : Mike65809


Marty Beazley
Evolution is the religion, because you must believe in things that are unverifiable. The proof of God is clearly seen.
Comment from : Marty Beazley


Mike65809
The truth seeker would welcome challenge to the standard understanding. Yet how many have ever even read one Creationist article, written by scientists who also have letters after their names? Ignorance is bliss.
Comment from : Mike65809


Henk Meiring
All that you know about fossils -they are dead.Why do you only show diagrams(drawings)?Because in reality they dont exist.After 20 years of looking at evolution videos ,i still cant understand why people that mock creationism,believe in science fiction that absolutely defy logic.Still waiting for convincing explanation that evolution is vaguely true.
Comment from : Henk Meiring


David Roberts
Survival of the luckiest. We need to make our own luck.
Comment from : David Roberts


Christopher Pitt
No serious scientist takes darwin seriously...David Berlinski,great mathematicians..if they don't they how can i?
Comment from : Christopher Pitt


edgar2prado
God created the world as it is right now. HIS INFALLIBLE WORDS IN THE BIBLE SAY SO. These idiots do not understand that fossils were just entertainment for him. And "added value" earth decoration for us. Do not dare to contradict me. I'm a very stable genius.
Comment from : edgar2prado


Don Haddix
Atheism is a religion. Evolution is a theory.
Comment from : Don Haddix


Number Six
Thirty years ago, one couldn't get a creationist to STOP talking about the history of the universe and the history of life. They would wax eloquently about the events of each and every one of the six days of creation and about the day of rest that followed the six.
Creationists won't talk about their model of creation any more. They have become so obsessed with "debunking" the theory of evolution that they simply cannot find time to share with us even the tiniest of morsels of the REAL histories of the early universe, earth and life.
Fortunately, the stories they told us in past (decades/centuries/millennia) are still accessible. If my schedule allows, over the next week, I'll be sharing with you, dear readers, the REAL history of, well, of everything - the history that creationists can no longer find time to speak of.
Please return tomorrow for "Installment 1" of what might modestly be called, "The Creationists' AMAZING history of EVERYTHING."

Comment from : Number Six


Michael Brown
Without sentience there would be no way for species to chose to adopt advantageous traits since the act of chosing can only be the result of an intelligent decision.
In a documentary on nature, the evolutionist narrator claimed that flowers made themselves beautiful and fragrant in order to lure insects to pollinating them. Did natural selection create the insects pollinator first or did it create the flower first? It would be a naturalistic miracle for the Australian hammer orchid to have ended up looking exactly like a female thynnid wasp complete with its mimicking its pheromone scent, in order to trick the male wasp into pollinating it. We know that evolutionism is founded on a materialistic methodology, and that it has no provision for miracles.

Comment from : Michael Brown


Paul Okada
If evolution is true how do we explain the different ethnicities here on Earth?
Comment from : Paul Okada


Charles Darwin the founder of evolution
amen brother
Comment from : Charles Darwin the founder of evolution


james arnett
Biased thinking. Just because no human found in fossil record, is not proof of evolution. This science falsely so called.
Comment from : james arnett


Red Pathfinder
I've heard of the theory of evolution. But I've never heard of the "fact of evolution"
Comment from : Red Pathfinder


Oussama Wop
It is not true, just a lie lol
Comment from : Oussama Wop


Number Six
Friday's Pop Quiz for Creationists
Did U238 decay when T-Rexes walked the earth? If so, what was the process' primary decay product? In your answer, please include the words "observable," "testable" and "repeatable."

Comment from : Number Six


Number Six
One might say that the creation model is so ridiculous that creationists won't explain it. It's worse that that. The creation model is so ridiculous that creationists won't even mention it. Read the creationists' comments below to see what I mean.
Comment from : Number Six


Number Six
@TheHairy Heathen.
It would appear that my post was not shadow-banned but that replies to it are being. In any case, here is my reply to your earlier reply:
--- I am well aware that the proton-proton chain reaction and the CNO cycle do not take place at the pressures and temperatures of the sun's photosphere. What would the fun have been in accurately describing those reactions or in detailing where they take place in my question TO CREATIONISTS!
--- As for the remainder of your answer, you've extrapolated to a degree that is not allowed by the creationists' "It isn't science if it isn't observable, testable and repeatable" argument.
--- <Smile> Please don't help creationists shoehorn their illogic into a discussion of science. Let them sink or swim on their own.
--- Thanks for your reply, nonetheless.

Comment from : Number Six


Jetee Phillips
Just another ogwash orator.
Comment from : Jetee Phillips


Number Six
Thursday's Pop Quiz for Creationists:
Did saber tooth tigers nurse their young? In your answer, please include the words "observable," "testable" and "repeatable."

Comment from : Number Six


Buckcub Mandingo
Who has opposable thumbs and found this topic interesting? This guy
Comment from : Buckcub Mandingo


Baba Dook
😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴😴
Comment from : Baba Dook


Number Six
Wednesday's pop quiz for creationists:
Were any of the photons that impacted earth's surface yesterday produced by nuclear fusion in the sun's photosphere? In your answer, please include the words "observable," "testable" and "repeatable."

Comment from : Number Six


AJ W
Man was here with the dinosaurs. God decided to remove the dinosaurs. God decided to make a change in his design as many do today in there work. How blind the people are.
Comment from : AJ W


AJ W
Nothing comes from nothing!!!!!!!!!!!!!!!!! God is real!!!!!!!!!!!!!!! God created it all and owns it all!!!!!!!!!!!
Comment from : AJ W


William Lopez
How can a animal go extinct why didn't they just evolve?
Comment from : William Lopez


Sid Spanos
By all of the elitest agreen upon a set point of view, funding for a pre determined outcome that benefits academia to overthrow anything left of spirituality. You can thank peer group review and the smithsonian institute for collecting anything that does not fit main stream science.
Comment from : Sid Spanos


Last Chance
Trotting out phylogeny and archeopterix after they have both been dismissed as proof for evolution, is disingenuous at best.
Comment from : Last Chance


Number Six
Today's pop quiz for creationists:
Did Pluto, Charon, Nix, Hydra, Styx and Kerberos jointly complete even one orbit of the Sun between 4 A.D. and 1,004 A.D. In your answer, please include the words "observable," "testable" and "repeatable."

Comment from : Number Six


L.Ron Dow
Firecloud77 seems to be one of those who deletes his thread when he knows he's lost the 'debate'. BE WARNED.
Here is a copy of the thread he deleted recently:
lrondowevo. blogspot. com/2020/03/firecloud77. html (remove the spaces)

Comment from : L.Ron Dow


Mark C
If any such smartypants actually believe that the perfection of nature all happened....millions and millions of species still being discovered, by a random lightning strike in a mud puddle, and cant or wont, believe in a Supreme Creator, than it is they that are having issues with limitations of their intelligence. Evolution examples are simply programmed developments God arranged.
Comment from : Mark C


Romulus Madison
The title of this video is misleading. Telling the history of a hypothesis doesn't make that hypothesis "true."
Comment from : Romulus Madison


Steve Bingham
Should be many animals in failed evolution over million of years that were adapting to another species and the fossil record does not show that.....many holes.
Comment from : Steve Bingham


Koksal Ceylan
Oh that is why the Victorians loved their Dogs so much,they were Romanics!.
Comment from : Koksal Ceylan


David Johnson
Dr John, you are begging the question. Demonstrate mutation for us. Natural selection, extinction, and change over time are obviously true but you totally failed to explain how slight, random changes to "old DNA" can produce "new DNA". That is the issue. Also, you must demonstrate an example of how this "new DNA" is randomly capable of building new working organs, not to mention new species. The burden is on you to show how unguided process can be the authors of useful code, new DNA. As it stands, we know that without intelligence you cannot produce information - and if you disagree with this please give evidence. As it stands random changes to data is still called corruption - not mutation. That is why the underlying mechanism to evolution remains myth.
Comment from : David Johnson



Related Nodata videos



Sansranaryal